KChannelDB: Extraction of mutation data from the literature

2005, KChannelDB.

This data was extracted from Medline abstracts and full texts (when available) in an automated manner.

The table below describes the selected point mutation and provides links to other documents. The sentence(s) where the point mutation R264E was found are listed after the table.

The mutated residues are also indicated in the family sequence alignments and hyperlinked to the corresponding mutation pages.

Point mutation R264E in KCAB2_HUMAN

Point mutation:	R264E
Domain:	Not determined
General numbering (KChannelDB):	-
Protein:	KCAB2_HUMAN (KCNAB2,KCNA2B, KCNK)	Swiss-Prot Cross-reference table Family page
Protein isoforms	2
Other point mutations / same protein / same position	Point mutations at position 264 in KCAB2_HUMAN
Other point mutations / same protein	List of mutations in KCAB2_HUMAN
Family alignments	Potassium channel beta subunits KvBeta
Other point mutations / same position	Position 316 in Potassium channel beta subunits KvBeta family
Reference:	Binding of pyridine nucleotide coenzymes to the beta-subunit of the voltage-sensitive K+ channel. Liu SQ, Jin H, Zacarias A, Srivastava S, Bhatnagar A J Biol Chem 2001 Apr 13;276(15):11812-20.	Medline
Other point mutations / same article	List
Text source	HTML full text
Validation status	Not yet checked

Relevant sentences:

R264E

The site-directed mutants R264E and N333W did not bind NADPH , whereas , the K d NADPH of Q214R was 10-fold greater than the wild-type protein
The tetrameric structure of the wild-type protein was retained by the R264E mutant , indicating that NADPH binding is not a prerequisite for multimer formation
The following primers were used: CTGGGGCACATCAATGTGGAGCTCCATGGAG (R189M) , GGTGCCATGACCGCGTCCCCTCTGGCGTGC (W243A) , GGTGCCATGACCTACTCCCCTCTGGCGTGC (W243Y) , CTGGTCCCCTCTGGCGTCCGGCATCGTC (C248S) , GTCTCAGGGAAGTTTGACAGCGGGATCCCAC (Y255F) , CCCATCTGCGAGCGAGCGGAATATCAC (Q214R) , CACCCTACTCCGAAGCCTCCCTGAAG (R264E) , CAACTTATGGAGTGGATTGGAGCAATACAG (N333W)
The fluorescence of R264E was not quenched even by the addition of 1 mM of NADPH
As expected , the freshly purified N333G and R264E proteins displayed a much stronger emission band at 335 nm than did equimolar concentrations of the WT or the C248S protein
Both the WT and C248S proteins displayed an additional band at 450 nm , which was absent in the emission spectra of the N333W and the R264E proteins (Fig. 6 ) , indicating that the N333W and R264E proteins do not bind NADPH
When excited at 340 nm (to elicit NADPH fluorescence) , both the WT and the C248S proteins displayed strong emission near 450 nm , whereas the N333W and the R264E proteins did not ; confirming that the N333W and R264E proteins do not contain NADPH bound to their active sites
To examine whether the lack of NADPH binding affects the quaternary structure of the protein , we determined the Strokes radius of R264E using size exclusion chromatography
The R264E protein eluted from the HPLC column with a retention time of 9.7 min (data not shown) , which was similar to the retention time of the WT protein , indicating that binding of NADPH is not essential for the formation of the Delta NK v beta 2 homotetramers
The fluorescence spectra of the WT , C248S , R264E , and N333G Delta NK v beta 2
This ionization may be due to Arg-264 , but the role of this residue could not be tested further because the R264E mutant did not bind NADPH
The predominant role of Arg-264 in pyridine coenzyme binding to K v beta 2 is suggested by the observation that the R264E mutation prevented NADPH binding (K d > 1 mM)
In contrast , the lack of coenzyme binding to the R264E mutant of K v beta 2 demonstrates that the same arginine residue binds to both the 2'-ribose phosphate and the pyrophosphate backbone of NADPH , as is evident from the crystal structure (12 )
Our results showing that R264E , which does not bind NADPH , is a homotetramer suggest that nucleotide binding is not a prerequisite for maintaining structural integrity or for K v beta -K v beta interactions
Specific mutations that can increase (C248S) , decrease (Q214E) , or prevent (R264E and N333W) NADPH binding to K v beta 2 were identified

F.Horn (kchanneldbcmbi.ru.nl), 17-Aug-2005